Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMV306hsp
(Plasmid #26155)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 26155 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMV306
  • Backbone size w/o insert (bp) 3938
  • Vector type
    Mycobacteria integrating vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    hsp60 promoter
  • Species
    Mycobacterium bovis BCG
  • Insert Size (bp)
    435

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer aaccgtattaccgcctttga
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The hsp60 promoter was obtained from pSMT3
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

There are a few sequence discrepancies between author sequence and Addgene quality control sequence for the hsp promoter. The hsp promoter sequence was taken from the pSMT3 vector and is theoretical sequence. These differences do not affect function.

Garbe, T.R., et al., Transformation of mycobacterial species using hygromycin resistance as selectable marker. Microbiology, 1994. 140 ( Pt 1): p. 133-8.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMV306hsp was a gift from Brian Robertson & Siouxsie Wiles (Addgene plasmid # 26155 ; http://n2t.net/addgene:26155 ; RRID:Addgene_26155)
  • For your References section:

    Optimisation of bioluminescent reporters for use with mycobacteria. Andreu N, Zelmer A, Fletcher T, Elkington PT, Ward TH, Ripoll J, Parish T, Bancroft GJ, Schaible U, Robertson BD, Wiles S. PLoS One. 2010 May 24;5(5):e10777. 10.1371/journal.pone.0010777 PubMed 20520722