pNIC-CH
(Plasmid #26117)

• Purpose: (Empty Backbone) SGC Empty backbone for bacterial expression
• Depositing Lab: Opher Gileadi
• Publication: pNIC-CH (unpublished)

Backbone

• Vector backbone: pNIC-CH
• Backbone manufacturer: SGC Oxford
• Backbone size (bp): 7218
• Vector type: Bacterial Expression
• Promoter: T7-lacO
• Tag / Fusion Protein:
  • His (C terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Cloning Information

• 5′ sequencing primer: T7
• 3′ sequencing primer: T7-term

Resource Information

• Supplemental Documents:
  • pNIC-CH
• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pET expression vector with C-terminal His6 tag. Includes sites for LIC cloning, and a “stuffer” fragment that includes the SacB gene, allowing negative selection on 5% sucrose. GenBank accession number: EF199843

Primers for LIC cloning:
Add the following 5’ extensions to the PCR primers:
Upstream: TTAAGAAGGAGATATACTATG (ATG-initiation codon)
Downstream: AATGGTGGTGATGATGGTGCGC
The purified PCR fragments are treated with T4 DNA polymerase and dGTP, then annealed to the treated vector. See supplemental document for more information.