pNIC-CTHF
(Plasmid #26105)

• Purpose: (Empty Backbone) SGC Empty backbone for bacterial expression
• Depositing Lab: Opher Gileadi
• Publication: Savitsky et al J Struct Biol. 2010 Jun 10. ():.

Backbone

• Vector backbone: pET-28-a
• Backbone manufacturer: Novagen
• Backbone size (bp): 5330
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: For plasmid propagation and cloning use any E. coli strain not expressing T7 RNA polymerase. For expression, use a strain that expresses T7 RNA polymerase, e.g. BL21(DE3).
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: None
• GenBank ID: EF199844
• Tag / Fusion Protein:
  • TEV - His6 - Flag (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Ligation-Independent cloning; cut with BfuAI (destroyed during cloning)
• 3′ cloning site: Ligation-Independent cloning; cut with BfuAI (destroyed during cloning)
• 5′ sequencing primer: T7F
• 3′ sequencing primer: T7R

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Primers for LIC cloning:

Upstream: add TTAAGAAGGAGATATACTATG to the 5’ end (ATG in-frame with the desired coding
sequence).

Downstream: add GATTGGAAGTAGAGGTTCTCTGC to 5’ end of downstream primer (no termination codon!)

Detailed cloning method available in the paper (Savitsky et al., J Struct Biol., 2010)