Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMLLKA-J72023
(Plasmid #26014)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 26014 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMLL-KA
  • Backbone size w/o insert (bp) 2646
  • Vector type
    Synthetic Biology ; 2ab assembly vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Kanamycin, 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Other
  • Growth instructions
    Provided in a pir+ strain. Grow at 37C
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    N terminal S tag with RBS
  • Alt name
    Bmll34
  • Alt name
    J72023
  • Insert Size (bp)
    87

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer gtatcacgaggcagaatttcag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note that this plasmid needs to be grown in both Kanamycin and Ampicillin

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMLLKA-J72023 was a gift from Christopher Anderson (Addgene plasmid # 26014 ; http://n2t.net/addgene:26014 ; RRID:Addgene_26014)