pFB-Flag-MyoD-E12
(Plasmid
#25990)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 25990 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFastBac1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4775
-
Vector typeBaculovirus transfer Vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMyoD-E12 Heterodimer Fusion
-
Alt nameMyoD forced heterodimer
-
Alt nameE12
-
Alt nameTCF3
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3013
-
GenBank IDBC103613
-
Entrez GeneMyod1 (a.k.a. MYF3, MyoD, Myod-1, bHLHc1)
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TATTCCGGATTATTCATACC
- 3′ sequencing primer CTGATTATGATCCTCTAGTAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFB-Flag-MyoD-E12 was a gift from Jeffrey Dilworth (Addgene plasmid # 25990 ; http://n2t.net/addgene:25990 ; RRID:Addgene_25990) -
For your References section:
In vitro transcription system delineates the distinct roles of the coactivators pCAF and p300 during MyoD/E47-dependent transactivation. Dilworth FJ, Seaver KJ, Fishburn AL, Htet SL, Tapscott SJ. Proc Natl Acad Sci U S A. 2004 Aug 10. 101(32):11593-8. 10.1073/pnas.0404192101 PubMed 15289617