pFUGW-H1 empty vector
(Plasmid #25870)

• Purpose: (Empty Backbone) 3rd generation lentiviral vector
• Depositing Lab: Sally Temple
• Publication: Fasano et al Cell Stem Cell. 2007 Jun 7. 1(1):87-99.

Backbone

• Vector backbone: FUGW-H1
• Backbone manufacturer: Ivanova, NB
• Backbone size (bp): 10130
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Zeo marker is outside the LTRs and will not be packaged into virus.

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: None
• Promoter: H1

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: see below (not destroyed)
• 3′ cloning site: see below (not destroyed)
• 5′ sequencing primer: H1 (5'-tcgctatgtgttctgggaaa-3')
• 3′ sequencing primer: cagtgcaggggaaagaatagtagac

Resource Information

• Supplemental Documents:
  • FUGW-H1 shRNA cloning protocol
• Articles Citing this Plasmid:
  • 19 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Empty Vector pFUGW-H1.

The H1 promoter was cloned into the PacI site of FUGW (Addgene Plasmid# 14883). Please see cloning protocol for recommended shRNA subcloning procedure.