Rix-PGK-Tom-W
(Plasmid #25813)

• Depositing Labs: Jozsef Kiss, Patrick Salmon
• Publication: Dayer et al Brain. 2007 Nov . 130(Pt 11):2962-76.

Backbone

• Vector backbone: Rix-PGK-W
• Backbone size w/o insert (bp): 6936
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: HB101 or Top10 are recommended for growing lentivector plasmids
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Rix-PGK-Tom-W
• Species: Red living color
• Insert Size (bp): 1428
• Mutation: tdTomato from Tsien lab

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: aggtggagagagagacagag

Resource Information

• Addgene Notes:
  • Addgene diagnostic digest

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

There are some discrepancies between Addgene's quality control sequence and the sequence from the depositing lab, but they should not affect the function of this plasmid.