Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Rix-PGK-Tom-W
(Plasmid #25813)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 25813 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Rix-PGK-W
  • Backbone size w/o insert (bp) 6936
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    HB101 or Top10 are recommended for growing lentivector plasmids
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rix-PGK-Tom-W
  • Species
    Red living color
  • Insert Size (bp)
    1428
  • Mutation
    tdTomato from Tsien lab

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer aggtggagagagagacagag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

There are some discrepancies between Addgene's quality control sequence and the sequence from the depositing lab, but they should not affect the function of this plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Rix-PGK-Tom-W was a gift from Jozsef Kiss & Patrick Salmon (Addgene plasmid # 25813 ; http://n2t.net/addgene:25813 ; RRID:Addgene_25813)
  • For your References section:

    Expression of FGF-2 in neural progenitor cells enhances their potential for cellular brain repair in the rodent cortex. Dayer AG, Jenny B, Sauvain MO, Potter G, Salmon P, Zgraggen E, Kanemitsu M, Gascon E, Sizonenko S, Trono D, Kiss JZ. Brain. 2007 Nov . 130(Pt 11):2962-76. 10.1093/brain/awm200 PubMed 17728358