-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 25812 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepWPI
- Backbone size w/o insert (bp) 11101
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepWPI_SPbFGF
-
Alt nameFGF2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)620
-
MutationIg signal peptide in N-terminal of human FGF2
-
Entrez GeneFGF2 (a.k.a. BFGF, FGF-2, FGFB, HBGF-2)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PmeI (destroyed during cloning)
- 3′ cloning site PmeI (destroyed during cloning)
- 5′ sequencing primer attctcaagcctcagacagt (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWPI_SPbFGF was a gift from Jozsef Kiss & Patrick Salmon (Addgene plasmid # 25812 ; http://n2t.net/addgene:25812 ; RRID:Addgene_25812) -
For your References section:
Expression of FGF-2 in neural progenitor cells enhances their potential for cellular brain repair in the rodent cortex. Dayer AG, Jenny B, Sauvain MO, Potter G, Salmon P, Zgraggen E, Kanemitsu M, Gascon E, Sizonenko S, Trono D, Kiss JZ. Brain. 2007 Nov . 130(Pt 11):2962-76. 10.1093/brain/awm200 PubMed 17728358