pLL3.7_hsa-miR-30c
(Plasmid #25797)

• Depositing Lab: Judy Lieberman
• Publication: Navarro et al Blood. 2009 Sep 3. 114(10):2181-92.

Backbone

• Vector backbone: pLL3.7
• Backbone size w/o insert (bp): 7650
• Vector type: Lentiviral, RNAi

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hsa-miR-30c
• Alt name: miR-30c
• Species: H. sapiens (human)
• Insert Size (bp): 210

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: n/a

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The pLL3.7 cassette containing the U6 promoter and a control short hairpin was replaced by a cassette containing the U6 promoter and an approx 300 bp genomic fragment for expression of the mature miRNA from pSIREN-RetroQ-miRNA expression vectors, kindly provided by Dr. B. Ramratnam, Brown University

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

miR-30c sequence: 5'TGTAAACATCCTACACTCTCAGC3'