pEN_TmiR_G13-L
(Plasmid
#25762)
-
PurposeEntry vector with TRE promoter driving mouse G alpha 13 miR30-based shRNA.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 25762 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepENTR1A-Gent
-
Backbone manufacturerATCC 10326362
- Backbone size w/o insert (bp) 4259
-
Vector typeEntry vector
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Growth instructionsTop10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameG alpha 13 miR-shRNA
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)22
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site attL1 (not destroyed)
- 3′ cloning site attL2 (not destroyed)
- 5′ sequencing primer pCEP-fwd
- 3′ sequencing primer n/a (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTRE promoter- David Anderson, Caltech; miR30- Greg Hannon, CSHL
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Entry vector with TRE-driven G alpha 13 miR-shRNA
G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT
Addgene sequence shows that this plasmid is missing the SpeI site.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEN_TmiR_G13-L was a gift from Iain Fraser (Addgene plasmid # 25762 ; http://n2t.net/addgene:25762 ; RRID:Addgene_25762) -
For your References section:
A single lentiviral vector platform for microRNA-based conditional RNA interference and coordinated transgene expression. Shin KJ, Wall EA, Zavzavadjian JR, Santat LA, Liu J, Hwang JI, Rebres R, Roach T, Seaman W, Simon MI, Fraser ID. Proc Natl Acad Sci U S A. 2006 Sep 12. 103(37):13759-64. 10.1073/pnas.0606179103 PubMed 16945906