pSLIK-Venus-TmiR-G12
(Plasmid #25740)

• Purpose: Lentiviral vector with Tet-based inducible expression of mouse G alpha 12 miR30-based shRNA, constitutive Venus fluorescent protein coexpression.
• Depositing Lab: Iain Fraser
• Publication: Shin et al Proc Natl Acad Sci U S A. 2006 Sep 12. 103(37):13759-64.

Backbone

• Vector backbone: pSLIK
• Backbone manufacturer: Iain Fraser
• Backbone size w/o insert (bp): 12370
• Vector type: Mammalian Expression, Lentiviral, RNAi

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Growth instructions: Top10
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: G alpha 12 miR-shRNA
• Alt name: G alpha 12
• Species: M. musculus (mouse)
• Insert Size (bp): 22
• Entrez Gene: Gna12 (a.k.a. Galpha12)
• Tag / Fusion Protein:
  • Venus (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BfuA1 (unknown if destroyed)
• 3′ cloning site: BfuA1 (unknown if destroyed)
• 5′ sequencing primer: CMV-F
• 3′ sequencing primer: EXFP-R, hUBCpro-R

Resource Information

• A portion of this plasmid was derived from a plasmid made by: rtTA- Atze Das, University of Amsterdam; TRE promoter- David Anderson, Caltech; miR30- Greg Hannon, CSHL Venus- Tobias Meyer, Stanford

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pSLIK-Venus with G alpha 12 miR-shRNA

G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT