-
Purpose(Empty Backbone) 3rd generation Lentiviral vector for Tet-based inducible shRNA or cDNA expression, constitutive Neomycin resistance gene coexpression.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 25735 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSLIK
-
Backbone manufacturerIain Fraser
- Backbone size (bp) 13286
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DB3.1
-
Growth instructionsDB3.1 (ccdB survival)
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNone
Cloning Information
- Cloning method Gateway Cloning
- 5′ cloning site attR1 (not destroyed)
- 3′ cloning site attR2 (not destroyed)
- 5′ sequencing primer CMV-F
- 3′ sequencing primer hUBCpro-R (CTAAGGCCGAGTCTTATGAGCAG) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byrtTA3- Atze Das, University of Amsterdam; NeoR- Clontech plasmid; pDS cassette- Invitrogen
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Parent lentivector, co-expression of Neomycin selection gene
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLIK-Neo was a gift from Iain Fraser (Addgene plasmid # 25735 ; http://n2t.net/addgene:25735 ; RRID:Addgene_25735) -
For your References section:
A single lentiviral vector platform for microRNA-based conditional RNA interference and coordinated transgene expression. Shin KJ, Wall EA, Zavzavadjian JR, Santat LA, Liu J, Hwang JI, Rebres R, Roach T, Seaman W, Simon MI, Fraser ID. Proc Natl Acad Sci U S A. 2006 Sep 12. 103(37):13759-64. 10.1073/pnas.0606179103 PubMed 16945906