-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 25699 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneFUW-TetO
- Backbone size w/o insert (bp) 8500
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLin28
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)642
-
Entrez GeneLin28a (a.k.a. Gm10299, Lin-28, Lin28, Tex17, lin-28A)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer AAAGTGAAAGTCGAGCTCGGTACC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FUW-TetO-mLIN28 was a gift from Rudolf Jaenisch (Addgene plasmid # 25699) -
For your References section:
Direct cell reprogramming is a stochastic process amenable to acceleration. Hanna J, Saha K, Pando B, van Zon J, Lengner CJ, Creyghton MP, van Oudenaarden A, Jaenisch R. Nature. 2009 Dec 3. 462(7273):595-601. 10.1038/nature08592 PubMed 19898493