-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 25443 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backboneYIPlac204
- Backbone size w/o insert (bp) 4100
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNLS-DsRed-Express2
-
Alt nameDsRed-Express2
-
SpeciesDiscosoma sp.
-
Insert Size (bp)714
-
GenBank IDFJ226077
-
Tag
/ Fusion Protein
- NLS (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer ACAGGTGGTTTGTTACGCATGCTAATGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
YIPlac204TC-NLS-DsRed-Express2 was a gift from Benjamin Glick (Addgene plasmid # 25443 ; http://n2t.net/addgene:25443 ; RRID:Addgene_25443) -
For your References section:
A noncytotoxic DsRed variant for whole-cell labeling. Strack RL, Strongin DE, Bhattacharyya D, Tao W, Berman A, Broxmeyer HE, Keenan RJ, Glick BS. Nat Methods. 2008 Nov . 5(11):955-7. 10.1038/nmeth.1264 PubMed 18953349
Map uploaded by the depositor.
