MDH1-PGK-GFP-miR9
(Plasmid #25036)

• Depositing Lab: Bob Weinberg
• Publication: Ma et al Nat Cell Biol. 2010 Mar . 12(3):247-56.

Backbone

• Vector backbone: MDH1-PGK-GFP 2.0
• Backbone manufacturer: Chang-Zheng Chen, Addgene plasmid 11375
• Backbone size w/o insert (bp): 6963
• Vector type: Mammalian Expression, Retroviral, RNAi

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mir-9-3
• Species: H. sapiens (human)
• Insert Size (bp): 313
• Entrez Gene: MIR9-3 (a.k.a. MIRN9-3, hsa-mir-9-3, miRNA9-3, mir-9-3)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: XhoI (unknown if destroyed)
• 5′ sequencing primer: EGFP-C
• 3′ sequencing primer: H1, tcgctatgtgttctgggaaa

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The mir-9-3 gene was PCR-amplified from normal human genomic DNA and cloned into the MDH-PGK-GFP 2.0 retroviral vector. It includes the miR-9 stem-loop and ~100bp flanking sequences on both sides.