pIS1-miR-206 site
(Plasmid
#25027)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 25027 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepIS1
-
Backbone manufacturerDavid Bartel, Addgene plasmid # 12179
- Backbone size w/o insert (bp) 4085
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesynthetic miR-206 site
-
Alt namemiR-206 binding site
-
Alt namemiR-206 reporter
-
Insert Size (bp)23
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (unknown if destroyed)
- 3′ cloning site AgeI (unknown if destroyed)
- 5′ sequencing primer Rluc-F (ccaggattcttttccaatgc)
- 3′ sequencing primer EBV-rev (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Renilla luciferase reporter for miR-206 constructed by cloning oligo containing synthetic miR-206 binding site (GCCATTGAGCTCTGGAATGTAAGGAAGTGTGTGGACCGGTGCCATT) into SacI and AgeI sites of the 3’ UTR of a pIS1 vector backbone.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIS1-miR-206 site was a gift from Bob Weinberg (Addgene plasmid # 25027 ; http://n2t.net/addgene:25027 ; RRID:Addgene_25027) -
For your References section:
A pleiotropically acting microRNA, miR-31, inhibits breast cancer metastasis. Valastyan S, Reinhardt F, Benaich N, Calogrias D, Szasz AM, Wang ZC, Brock JE, Richardson AL, Weinberg RA. Cell. 2009 Jun 12. 137(6):1032-46. 10.1016/j.cell.2009.03.047 PubMed 19524507