Skip to main content
Addgene

pIS1-miR-126 site
(Plasmid #25026)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 25026 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pIS1
  • Backbone manufacturer
    David Bartel, Addgene plasmid # 12179
  • Backbone size w/o insert (bp) 4085
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    synthetic miR-126 site
  • Alt name
    miR-126 reporter
  • Insert Size (bp)
    23

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (unknown if destroyed)
  • 3′ cloning site AgeI (unknown if destroyed)
  • 5′ sequencing primer Rluc-F (ccaggattcttttccaatgc)
  • 3′ sequencing primer EBV-rev
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Renilla luciferase reporter for miR-126 constructed by cloning oligo containing synthetic miR-126 binding site (GCCATTGAGCTCTCGTACCGTGAGTAATAATGCGACCGGTGCCATT) into SacI and AgeI sites of the 3’ UTR of a pIS1 vector backbone.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIS1-miR-126 site was a gift from Bob Weinberg (Addgene plasmid # 25026 ; http://n2t.net/addgene:25026 ; RRID:Addgene_25026)
  • For your References section:

    A pleiotropically acting microRNA, miR-31, inhibits breast cancer metastasis. Valastyan S, Reinhardt F, Benaich N, Calogrias D, Szasz AM, Wang ZC, Brock JE, Richardson AL, Weinberg RA. Cell. 2009 Jun 12. 137(6):1032-46. 10.1016/j.cell.2009.03.047 PubMed 19524507