LZRS-DNMT1
(Plasmid #24952)

• Depositing Lab: Paul Khavari
• Publication: Sen et al Nature. 2010 Jan 28. 463(7280):563-7.

Backbone

• Vector backbone: LZRS
• Backbone size w/o insert (bp): 11100
• Vector type: Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: DNMT1
• Species: H. sapiens (human)
• Entrez Gene: DNMT1 (a.k.a. ADCADN, AIM, CXXC9, DNMT, HSN1E, MCMT, m.HsaI)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: TGGATACACGCCGCCCACGTG
• 3′ sequencing primer: ATCGTCGACCACTGTGCTGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: full length WT DNMT1 cDNA from Open Biosystems
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry