pN1-Lck-GCaMP2
(Plasmid #24794)

• Depositing Lab: Baljit Khakh
• Publication: Shigetomi et al Nat Neurosci. 2010 Jun;13(6):759-66.

Backbone

• Vector backbone: pEGFP-N1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 3950
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Lck-GCaMP2
• Alt name: GCaMP
• Alt name: GCaMP2
• Alt name: Lck-GCaMP
• Insert Size (bp): 1480
• Mutation: Plasmid contains N-terminal 26 amino acid membrane targeting sequence of Lck (Src tyrosine kinase) fused to GCaMP2. 6xHis and Xpress (FLAG-like) epitope tags contained within 'RSET' sequence, making up the linker region between Lck and GCaMP2
• Tags / Fusion Proteins:
  • His
  • Xpress

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: ACGGTGGGAGGTCTATATAAGCAGAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: A. Sagasti (UCLA) for the GCaMP2 plasmid and D.E. Bergles (Johns Hopkins) for the Lck domain containing plasmid.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry