pFunnyfarm
(Plasmid
#24755)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 24755 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAsylum
-
Backbone manufacturerChristopher Buck lab, Addgene plasmid 24754
- Backbone size w/o insert (bp) 1851
-
Vector typeGateway-adapted entry vector
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Bleocin (Zeocin), 25 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Growth instructionsccdB survival
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCAT-ccdB cassette
-
SpeciesN/A
-
Insert Size (bp)2497
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer M13/pUC Forward
- 3′ sequencing primer AsyR (CTGAAAGAGGAACTTGGTTAGG) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFunnyfarm was a gift from Christopher Buck (Addgene plasmid # 24755 ; http://n2t.net/addgene:24755 ; RRID:Addgene_24755) -
For your References section:
Merkel cell polyomavirus and two previously unknown polyomaviruses are chronically shed from human skin. Schowalter RM, Pastrana DV, Pumphrey KA, Moyer AL, Buck CB.. Cell Host Microbe. 2010 Jun 25;7(6):509-15. 10.1016/j.chom.2010.05.006 PubMed 20542254