-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 24728 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFunnyfarm
-
Backbone manufacturerChristopher Buck lab, Addgene plasmid 24755
- Backbone size w/o insert (bp) 2131
-
Vector typeViral clone
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFull genome of Human polyomavirus 7
-
Alt namePolyomavirus HPyV7 isolate 713a
-
Speciespolyomavirus
-
Insert Size (bp)4957
-
GenBank IDHM011566
Cloning Information
- Cloning method Gateway Cloning
- 5′ cloning site attPI (destroyed during cloning)
- 3′ cloning site AttP2 (destroyed during cloning)
- 5′ sequencing primer M13/pUC Forward
- 3′ sequencing primer AsyR (CTGAAAGAGGAACTTGGTTAGG) (Common Sequencing Primers)
Resource Information
-
Reference
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
genome can be liberated by digestion with Mfe I.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHPyV7-713a was a gift from Christopher Buck (Addgene plasmid # 24728 ; http://n2t.net/addgene:24728 ; RRID:Addgene_24728) -
For your References section:
Merkel cell polyomavirus and two previously unknown polyomaviruses are chronically shed from human skin. Schowalter RM, Pastrana DV, Pumphrey KA, Moyer AL, Buck CB.. Cell Host Microbe. 2010 Jun 25;7(6):509-15. 10.1016/j.chom.2010.05.006 PubMed 20542254