pFloxin-Ofd1-Myc-S437R
(Plasmid
#24577)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 24577 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBluescript
- Backbone size w/o insert (bp) 4021
-
Vector typeMouse Targeting, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl2
-
Growth instructionsStbl2 (Invitrogen) or other RecA- strain 37 degrees in LB media
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameOfd1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2781
-
MutationSerine 437 changed to Arginine (codon AGT to CGT) Includes exons 4-23 only
-
GenBank IDNM_177429
-
Entrez GeneOfd1 (a.k.a. ORF2, Cxorf5, DXGgc7e)
-
Tag
/ Fusion Protein
- Myc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer aacctctgccctttctcctc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Mutation reported in:
Identification of the gene for oral-facial-digital type I syndrome.
Ferrante MI, Giorgio G, Feather SA, Bulfone A, Wright V, Ghiani M, Selicorni A, Gammaro L, Scolari F, Woolf AS, Sylvie O, Bernard L, Malcolm S, Winter R, Ballabio A, Franco B.
Am J Hum Genet. 2001 Mar;68(3):569-76. Epub 2001 Feb 13.PMID: 11179005
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFloxin-Ofd1-Myc-S437R was a gift from Jeremy Reiter (Addgene plasmid # 24577 ; http://n2t.net/addgene:24577 ; RRID:Addgene_24577) -
For your References section:
Ofd1, a human disease gene, regulates the length and distal structure of centrioles. Singla V, Romaguera-Ros M, Garcia-Verdugo JM, Reiter JF. Dev Cell. 2010 Mar 16. 18(3):410-24. 10.1016/j.devcel.2009.12.022 PubMed 20230748