pFloxin-IRES-Ofd1-Myc-G139S
(Plasmid #24576)

• Depositing Lab: Jeremy Reiter
• Publication: Singla et al Dev Cell. 2010 Mar 16. 18(3):410-24.

Backbone

• Vector backbone: pBluescript
• Backbone size w/o insert (bp): 4873
• Vector type: Mouse Targeting, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl2
• Growth instructions: Stbl2 (Invitrogen) or other RecA- strain 37 degrees in LB media
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Ofd1
• Species: M. musculus (mouse)
• Insert Size (bp): 3087
• Mutation: Glycine 139 changed to serine (codon GGT to AGT)
• GenBank ID: NM_177429
• Entrez Gene: Ofd1 (a.k.a. ORF2, Cxorf5, DXGgc7e)
• Tag / Fusion Protein:
  • Myc (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: tcggtgcacatgctttacat

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Mutation reported in:

Clinical, molecular, and genotype-phenotype correlation studies from 25 cases of oral-facial-digital syndrome type 1: a French and Belgian collaborative study.

Thauvin-Robinet C, Cossée M, Cormier-Daire V, Van Maldergem L, Toutain A, Alembik Y, Bieth E, Layet V, Parent P, David A, Goldenberg A, Mortier G, Héron D, Sagot P, Bouvier AM, Huet F, Cusin V, Donzel A, Devys D, Teyssier JR, Faivre L.

J Med Genet. 2006 Jan;43(1):54-61.PMID: 16397067