pRRL CAG NFlag BAF170 ires GFP
(Plasmid #24562)

• Depositing Lab: Jerry Crabtree
• Publication: Ho et al Proc Natl Acad Sci U S A. 2009 Mar 31. 106(13):5181-6.

Backbone

• Vector backbone: pRRL-sin18PPT CAG-ires-GFP
• Backbone size w/o insert (bp): 9200
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL10 Gold
• Growth instructions: XL-10 Gold, Stratagene
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: BAF170
• Alt name: smarcc2
• Species: M. musculus (mouse)
• Insert Size (bp): 3600
• GenBank ID: NM_001114097
• Entrez Gene: Smarcc2 (a.k.a. 5930405J04Rik)
• Tag / Fusion Protein:
  • Flag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Age1 (not destroyed)
• 3′ cloning site: Pst1 (not destroyed)
• 5′ sequencing primer: gctaaccatgttcatgccttc

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry