Skip to main content
Addgene

pRRL CAGpNFlag BAF155 ires GFP
(Plasmid #24561)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 24561 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pRRL-sin18PPT CAG-ires-GFP
  • Backbone size w/o insert (bp) 9200
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Growth instructions
    XL-10 Gold, Stratagene
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    BAF155
  • Alt name
    Smarcc1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    3300
  • GenBank ID
    NM_009211
  • Entrez Gene
    Smarcc1 (a.k.a. AI115498, BAF15, BAF155, Rsc8, SR, SRG3, ms, msp3)
  • Tag / Fusion Protein
    • Flag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Age1 (not destroyed)
  • 3′ cloning site Pst1 (not destroyed)
  • 5′ sequencing primer gctaaccatgttcatgccttc
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Open Biosystems cDNA clone
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRRL CAGpNFlag BAF155 ires GFP was a gift from Jerry Crabtree (Addgene plasmid # 24561 ; http://n2t.net/addgene:24561 ; RRID:Addgene_24561)

  • For your References section:

    An embryonic stem cell chromatin remodeling complex, esBAF, is essential for embryonic stem cell self-renewal and pluripotency. Ho L, Ronan JL, Wu J, Staahl BT, Chen L, Kuo A, Lessard J, Nesvizhskii AI, Ranish J, Crabtree GR. Proc Natl Acad Sci U S A. 2009 Mar 31. 106(13):5181-6. 10.1073/pnas.0812889106 PubMed 19279220
Related items:
Commonly requested with: