pFloxin-Ofd1-Myc
(Plasmid #24558)

• Depositing Lab: Jeremy Reiter
• Publication: Singla et al Nat Methods. 2010 Jan . 7(1):50-2.

Backbone

• Vector backbone: pBluescript
• Backbone size w/o insert (bp): 4021
• Vector type: Mouse Targeting, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl2
• Growth instructions: Stbl2 (Invitrogen) or other RecA- strain 37 degrees in LB media
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Ofd1
• Species: M. musculus (mouse)
• Insert Size (bp): 2781
• Mutation: includes exons 4-23 only
• GenBank ID: NM_177429
• Entrez Gene: Ofd1 (a.k.a. ORF2, Cxorf5, DXGgc7e)
• Tag / Fusion Protein:
  • Myc (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: aacctctgccctttctcctc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Also see the following article:
Ofd1, a human disease gene, regulates the length and distal structure of centrioles.

Singla V, Romaguera-Ros M, Garcia-Verdugo JM, Reiter JF.

Dev Cell. 2010 Mar 16;18(3):410-24.PMID: 20230748