Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pFloxin-IRES-eGFP
(Plasmid #24557)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 24557 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBluescript
  • Backbone size w/o insert (bp) 4557
  • Vector type
    Mouse Targeting, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl2
  • Growth instructions
    Stbl2 (Invitrogen) or other RecA- strain 37 degrees in LB media
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    eGFP
  • Species
    A. victoria
  • Insert Size (bp)
    717

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (destroyed during cloning)
  • 3′ cloning site EcoRV (destroyed during cloning)
  • 5′ sequencing primer tcggtgcacatgctttacat
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFloxin-IRES-eGFP was a gift from Jeremy Reiter (Addgene plasmid # 24557 ; http://n2t.net/addgene:24557 ; RRID:Addgene_24557)
  • For your References section:

    Floxin, a resource for genetically engineering mouse ESCs. Singla V, Hunkapiller J, Santos N, Seol AD, Norman AR, Wakenight P, Skarnes WC, Reiter JF. Nat Methods. 2010 Jan . 7(1):50-2. 10.1038/nmeth.1406 PubMed 19966808