pFloxin-IRES-eGFP
(Plasmid
#24557)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 24557 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBluescript
- Backbone size w/o insert (bp) 4557
-
Vector typeMouse Targeting, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl2
-
Growth instructionsStbl2 (Invitrogen) or other RecA- strain 37 degrees in LB media
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameeGFP
-
SpeciesA. victoria
-
Insert Size (bp)717
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (destroyed during cloning)
- 3′ cloning site EcoRV (destroyed during cloning)
- 5′ sequencing primer tcggtgcacatgctttacat (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFloxin-IRES-eGFP was a gift from Jeremy Reiter (Addgene plasmid # 24557 ; http://n2t.net/addgene:24557 ; RRID:Addgene_24557) -
For your References section:
Floxin, a resource for genetically engineering mouse ESCs. Singla V, Hunkapiller J, Santos N, Seol AD, Norman AR, Wakenight P, Skarnes WC, Reiter JF. Nat Methods. 2010 Jan . 7(1):50-2. 10.1038/nmeth.1406 PubMed 19966808