-
Depositing Labs
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 24520 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepECFPC1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4731
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameECFP, EYFP
-
Alt nameCFP,YFP
-
SpeciesVibrio fischeri
-
Insert Size (bp)757
-
GenBank IDP21578
-
Tags
/ Fusion Proteins
- ECFP (C terminal on backbone)
- EYFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bsp E1 (unknown if destroyed)
- 3′ cloning site Bgl II (unknown if destroyed)
- 5′ sequencing primer AAGTCCGGAATGGTGAGCAAGGGCGAGGA
- 3′ sequencing primer TCAAGATCTCTTGTACAGCTCGTCCATGCC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-ECFPEYFP was a gift from Liusheng He & Jehonathan Pinthus (Addgene plasmid # 24520 ; http://n2t.net/addgene:24520 ; RRID:Addgene_24520) -
For your References section:
A flow cytometric method to detect protein-protein interaction in living cells by directly visualizing donor fluorophore quenching during CFP-->YFP fluorescence resonance energy transfer (FRET). He L, Olson DP, Wu X, Karpova TS, McNally JG, Lipsky PE. Cytometry A. 2003 Oct . 55(2):71-85. 10.1002/cyto.a.10073 PubMed 14505312