Y pFe-YcLoxP-YnAtt
(Plasmid #24510)

• Depositing Lab: Jehonathan Pinthus
• Publication: Lu et al Nat Prec (2008).

Backbone

• Vector backbone: pVitro2
• Backbone manufacturer: Invivogen
• Backbone size w/o insert (bp): 7434
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Kanamycin, 25 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Growth instructions: ccdB resistance E. Coli like Invitrogen’s One Shot® ccdB Survival™-T1R Chemically Competent Cells
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Yn, Yc, ECFP, EYFP
• Alt name: CFP, YFP, ECFP, EYFP
• Species: Aequorea victoria (Jellyfish)
• Insert Size (bp): 716
• GenBank ID: P42212
• Tags / Fusion Proteins:
  • ECFP (C terminal on backbone)
  • EYFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: clonase (destroyed during cloning)
• 3′ cloning site: recombinase (destroyed during cloning)
• 5′ sequencing primer: E LoxP-Rcmb GGCCTCGTACTACGCCTATT
• 3′ sequencing primer: TCCGGATGAGCATTCATCAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: 1. He, L. et al. Flow cytometric measurement of fluorescence (Forster) resonance energy transfer from cyan fluorescent protein to yellow fluorescent protein using single-laser excitation at 458 nm. Cytometry A. 53, 39-54 (2003).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note: This plasmid has been partially sequenced. Due to the presence of repeated features in the plasmid that prohibit thorough sequencing, the provided sequence should be considered theoretical and could contain errors.

Please refer to Lu, Jian-Ping, Beatty, Laura, and Pinthus, Jehonathan . Dual expression recombinase based (DERB) single vector system for high throughput screening and verification of protein interactions in living cells. Available from Nature Precedings <http://hdl.handle.net/10101/npre.2008.1550.2 > (2008)

http://precedings.nature.com/documents/1550/version/2