CMV::SypHy A4
(Plasmid #24478)

• Depositing Lab: Leon Lagnado
• Publication: Granseth et al Neuron. 2006 Sep 21. 51(6):773-86.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 3952
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SypHy
• Alt name: Rat Synaptophysin-pHluorin
• Species: R. norvegicus (rat)
• Insert Size (bp): 1665
• Entrez Gene: Syp (a.k.a. Syp1)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xho1 (not destroyed)
• 3′ cloning site: Not1 (destroyed during cloning)
• 5′ sequencing primer: cctctacaaatgtggtatggc

Resource Information

• Addgene Notes:
  • Full plasmid sequence obtained by Addgene user
• Articles Citing this Plasmid:
  • 10 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The depositing lab notes that the Xba1 and Bcl1 unique restriction digestion sites could be methylated and blocked if the plasmid is grown or maintained in dam+ bacteria.

Also note that in the Addgene-generated map below, the feature listed as "GFP(12-708)" is actually pH sensitive pHluorin.

There is a mutation S446T in Synaptophysin ORF. This change does not have any effect in localizing the construct to the synaptic vesicle and may be a result of a SNP.