pCMV-QS
(Plasmid #24340)

• Depositing Lab: Liqun Luo
• Publication: Potter et al Volume 141, Issue 3, 536-548, 30 April 2010

Backbone

• Vector backbone: pcDNA3.1-Myc-His-A
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5493
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: QS
• Species: Neurospora crassa
• Insert Size (bp): 2750
• Tags / Fusion Proteins:
  • Myc (C terminal on insert)
  • His (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Acc65I (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: CMV-F

Resource Information

• Reference:
  • pCMV-QS (GenBank)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

QS cDNA was obtained by PCR using primers PR53
(aatggtacccaacatgaacaccatcccggcac) and PR54 (aatgcggccgctcaagatatttgcgttgcaattc) using a
cosmid, pLorist-HO35F3 from the Fungal Genetics Stock Center, as the template. The PCR
fragment was initially cloned into pPAC5C-PL using Acc65 I and NotI to obtain the QS gene
containing a single intron. The intron was subsequently removed by creating two PCR products that
were cloned using 3-way ligation into pCDNA3.1-Mys-His-A (Invitrogen) using Acc65I and NotI and
blunt ends at the exon-exon junction. The primers used to create the first exon are: PR53 (see
above) + PR190 (agagcctagaggtactctgtgggcgg); and the second exon are: PR58
(tggtcggcgcccaattcc) + PR54 (see above).

A stop codon precedes the Myc and His tags.