shRNA GR
(Plasmid #24095)

• Depositing Lab: Moses Chao
• Publication: Jeanneteau et al Proc Natl Acad Sci U S A. 2008 Mar 25. 105(12):4862-7.

Backbone

• Vector backbone: pLentiLox 3.7
• Backbone size w/o insert (bp): 7650
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Glucocorticoid Receptor
• Alt name: GR
• Species: R. norvegicus (rat)
• Insert Size (bp): 80
• Entrez Gene: Nr3c1 (a.k.a. GR, Gcr, Grl)
• Tag / Fusion Protein:
  • GFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HpaI (unknown if destroyed)
• 3′ cloning site: XhoI (unknown if destroyed)
• 5′ sequencing primer: TRC-F

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

We designed an shRNA targeting the rat GR sequence in the pLentiLox3.7 (ATCC) plasmid carrying a GFP reporter: forward sequence, 5′-tgcgggagaagatgatccattcttcaagagagaatggatcatcttctcccgcttttttgaattc; reverse sequence, 5′-tcgagaattcaaaaaagcgggagaagatgatccattctctcttgaagaatggatcatcttctcccgca.