ACE2-Mutant-C3
(Plasmid
#240607)
-
PurposeTo test ACE2 cleavage by TMPRSS2. This protease targets R and K amino acids of ACE2, so these amino acids were substituted by A at Cluster 3 located within the collectrin-like site on ACE2
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 240607 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1(-)
- Backbone size w/o insert (bp) 5378
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAngiotensin-converting enzyme 2
-
Alt nameACE2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2472
-
MutationArginine (R) and Lysine (K) residues on ACE2-cluster 3 (C3 amio acids range 676-689) are substituted by alanine (A)
-
Entrez GeneACE2 (a.k.a. ACEH)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CMV Promoter (F): ATTGACGCAAATGGGCGGTA
- 3′ sequencing primer bGH-R primer: TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byHyeryun Choe (Addgene Plasmid #1786)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The sequences encoding ACE2 mutants with a C-terminal FLAG tag were generated in two steps. In step 1, ACE2 mutant inserts were generated by overlap-extension PCR with specific primers. In step 2, the mutated ACE2 PCR insert was inserted into pcDNA 3.1 vector using the NEBuilder HiFi DNA Assembly kit. The integrity of all PCR-amplified sequences was confirmed by automated sequence analysis.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ACE2-Mutant-C3 was a gift from Zaid Abassi (Addgene plasmid # 240607 ; http://n2t.net/addgene:240607 ; RRID:Addgene_240607)