Skip to main content
Addgene

FUGW U6 gLacZ dCas9-KRAB-T2a-GFP
(Plasmid #234883)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 234883 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-GFP
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    L1HS gRNA
  • gRNA/shRNA sequence
    GTCTTCTGCGTCGCTCACGC
  • Species
    H. sapiens (human)
  • Tag / Fusion Protein
    • GFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer gagggcctatttcccatgattcc
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.01.17.633315 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FUGW U6 gLacZ dCas9-KRAB-T2a-GFP was a gift from Johan Jakobsson (Addgene plasmid # 234883 ; http://n2t.net/addgene:234883 ; RRID:Addgene_234883)

  • For your References section:

    LINE-1 retrotransposons regulate the exit of human pluripotency and early brain development. Adami A, Garza R, Gerdes P, Johansson PA, Dorazehi F, Koutounidou S, Castilla-Vallmanya L, Atacho DAM, Sharma Y, Johansson JG, Tam O, Kirkeby A, Barker RA, Gale-Hammell M, Douse CH, Jakobsson J. bioRxiv 2025.01.17.633315 10.1101/2025.01.17.633315
Related items: