PGK-GFP-LAMP1TM
(Plasmid #234874)

• Purpose: Lentiviral plasmid expressing GFP fused to the transmembrane domain and cytosolic tail of LAMP-1. Designed as a control vector for PGK-HA-PGRN-LAMP1TM.
• Depositing Lab: Andrew Arrant
• Publication: Davis et al J Biol Chem. 2021 Sep;297(3):100993. doi: 10.1016/j.jbc.2021.100993. Epub 2021 Jul 21.

Backbone

• Vector backbone: pRRLSIN.cPPT.PGK-GFP.WPRE
• Backbone manufacturer: Didier Trono (Addgene #12252)
• Backbone size w/o insert (bp): 6661
• Total vector size (bp): 7495
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EGFP
• Insert Size (bp): 834
• Promoter: PGK
• Tag / Fusion Protein:
  • LAMP-1 transmembrane domain and cytosolic tail (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: gggtgtggggcggtagtg
• 3′ sequencing primer: cataaagagacagcaaccagga

Resource Information

• Supplemental Documents:
  • pRRL with L-GFP.gb
• A portion of this plasmid was derived from a plasmid made by: IDT (LAMP-1 TM obtained as G block and cloned into Addgene #12252)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry