NSP13:5325-5925_BV
(Plasmid
#234374)
-
PurposeBaculovirus expression for structure determination. May not contain entire coding region of gene.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 234374 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFBOH-MHL
-
Backbone manufacturerCheryl Arrowsmith, Addgene Plasmid #62304
-
Vector typeBaculovirus Expresssion
-
Selectable markersHigh Copy
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNsp13_SARS2
-
SpeciesSevere acute respiratory syndrome coronavirus 2
- Promoter Polyhedrin
-
Tag
/ Fusion Protein
- MHHHHHHSSGRENLYFQG (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer pFBOH-fwd (CCGGATTATTCATACCGTCCCACCA)
- 3′ sequencing primer pFBOH-rev (5'-CTGATTATGATCCTCTAGTACTTCT-3') (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NSP13:5325-5925_BV was a gift from Cheryl Arrowsmith (Addgene plasmid # 234374 ; http://n2t.net/addgene:234374 ; RRID:Addgene_234374)