pSM-mStayGold
(Plasmid #234317)

• Purpose: codon-optimized mStayGold with synthetic introns for the expression in C. elegans
• Depositing Lab: Kota Mizumoto
• Publication: Ko et al MicroPubl Biol. 2025 Jan 18;2025:10.17912/micropub.biology.001447. doi: 10.17912/micropub.biology.001447. eCollection 2025.

Backbone

• Vector backbone: pSM
• Backbone manufacturer: Cori Bargmann's lab
• Backbone size w/o insert (bp): 3600
• Total vector size (bp): 4331
• Vector type: Worm Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: C. elegans codon optimized mStayGOld
• Alt name: ce_mStayGold
• Species: Synthetic
• Insert Size (bp): 870
• GenBank ID:
• Tag / Fusion Protein:
  • mStayGold

Cloning Information

• Cloning method: Gene Synthesis
• 5′ sequencing primer: atgaccatgattacgccaa
• 3′ sequencing primer: gttgaagagtaattggacttag

Resource Information

• Supplemental Documents:
  • pSM.ce_mStayGold.ape
• A portion of this plasmid was derived from a plasmid made by: This plasmid was generated by replacing the GFP sequence in the pSM (eGFP_unc-54 utr) plasmid with codon-optimized mStayGold.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The original mStayGold was described in the following paper.
StayGold variants for molecular fusion and membrane-targeting applications. Ando R, Shimozono S, Ago H, Takagi M, Sugiyama M, Kurokawa H, Hirano M, Niino Y, Ueno G, Ishidate F, Fujiwara T, Okada Y, Yamamoto M, Miyawaki A. Nat Methods. 2023 Nov 30. doi: 10.1038/s41592-023-02085-6. 10.1038/s41592-023-02085-6 PubMed 38036853