BIC-Gag-DDX3
(Plasmid #233687)

• Purpose: Expresses a fusion between the Murine Leukemia Virus Gag polyprotein and the human DDX3 protein to produce virus-like particles loaded with DDX3 and deliver it to target cells.
• Depositing Lab: Emiliano Ricci
• Publication: Labaronne et al Nat Commun. 2025 Feb 18;16(1):1706. doi: 10.1038/s41467-025-56772-3.

Backbone

• Vector backbone: pCDNA3-like
• Backbone size w/o insert (bp): 6476
• Total vector size (bp): 8486
• Vector type: Mammalian Expression, Retroviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: DEAD-box helicase 3
• Alt name: DDX3
• Species: H. sapiens (human)
• Insert Size (bp): 2010
• Entrez Gene: DDX3X (a.k.a. CAP-Rf, DBX, DDX14, DDX3, HLP2, MRX102, MRXSSB)
• Promoter: hCMV
• Tag / Fusion Protein:
  • Gag (Murine Leukemia Virus) (N terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CTGACGCGTAGTTCCCTGTATCC
• 3′ sequencing primer: CCACCTTCTGATAGGCAGCC

Resource Information

• Supplemental Documents:
  • bic_flag_ddx3.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry