pTon1(il11)
(Plasmid #233647)

• Purpose: Expression vector of X. laevis il11.L-P2A-AcGFP1 under control of tetracycline responsive element (TRE). Also express Tet-on advenced transactivator (rtTA) under control of minimal CMV promoter.
• Depositing Lab: Takeo Kubo
• Publication: Tsujioka et al Nat Commun. 2017 Sep 8;8(1):495. doi: 10.1038/s41467-017-00594-5.

Backbone

• Vector backbone: pTRE-tight
• Backbone manufacturer: Clontech
• Total vector size (bp): 6194
• Vector type: Amphibian Expression, Tet-on

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: interleukin-11.L (350-913)
• Species: X. laevis (frog)
• Insert Size (bp): 564
• Mutation: Some synonymous substitutions were introduced in the il11.L sequence (see ref.)
• Entrez Gene: il11.L (a.k.a. agif, il-11, il11)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATGAAAAGCAGTTTGTGCCA
• 3′ sequencing primer: CAACTTGTTCTTCATCAGAA

Gene/Insert 2

• Gene/Insert name: target sequence of guide RNA #tyr (3905-3927) 5'-GGCTCCATGTCTTCCGTCCAAGG-3'
• Species: X. laevis (frog)
• Insert Size (bp): 23

Cloning Information for Gene/Insert 2

• Cloning method: Other
• 5′ sequencing primer: GGCTCCATGTCTTCCGTCCAAGG
• 3′ sequencing primer: CCTTGGACGGAAGACATGGAGCC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry