-
PurposeRetroviral construct of the MitoTRACER genetic reporter to be expressed in the donor cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 233505 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMXs rtv-016
-
Backbone manufacturerCell BioLabs
- Total vector size (bp) 6931
-
Modifications to backboneAddition of the MitoTRACER
-
Vector typeMammalian Expression, Retroviral, Synthetic Biology
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMitoTRACER-Donor
-
SpeciesSynthetic
-
Tag
/ Fusion Protein
- GFP11 and HA Tag
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgctggaaaggaccttacacagt
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
[#GS5-RV] MitoTRACER-Donor was a gift from Simon Grelet (Addgene plasmid # 233505 ; http://n2t.net/addgene:233505 ; RRID:Addgene_233505) -
For your References section:
Nerve-to-cancer transfer of mitochondria during cancer metastasis. Hoover G, Gilbert S, Curley O, Obellianne C, Lin MT, Hixson W, Pierce TW, Andrews JF, Alexeyev MF, Ding Y, Bu P, Behbod F, Medina D, Chang JT, Ayala G, Grelet S. Nature. 2025 Jun 25. doi: 10.1038/s41586-025-09176-8. 10.1038/s41586-025-09176-8 PubMed 40562940