YjdC-R82A_pET-14b
(Plasmid
#233276)
-
PurposeOverexpress his-tag YjdC protein with a site directed mutagenesis, arginine at position 82 was substituted with alanine (R82A)
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 233276 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET-14b
- Backbone size w/o insert (bp) 4671
- Total vector size (bp) 5115
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsUse BL21 for protein expression.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameYjdC
-
Insert Size (bp)576
-
MutationArginine was replaced with Alanine at position 82 (R82A)
-
GenBank IDGene ID: 948650
-
Entrez GeneyjdC (a.k.a. b4135, ECK4129, cutA3)
- Promoter T7 promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GGGAATTCATGCAAAGGGAGGATGTACT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGenscript manufacture the gene as per my request with the modifications
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
YjdC-R82A_pET-14b was a gift from Mohan Babu & Andrew Emili (Addgene plasmid # 233276 ; http://n2t.net/addgene:233276 ; RRID:Addgene_233276) -
For your References section:
Ligand interaction landscape of transcription factors and essential enzymes in E. coli. Peng H, Kotelnikov S, Egbert ME, Ofaim S, Stevens GC, Phanse S, Saccon T, Ignatov M, Dutta S, Istace Z, Moutaoufik MT, Aoki H, Kewalramani N, Sun J, Gong Y, Padhorny D, Poda G, Alekseenko A, Porter KA, Jones G, Rodionova I, Guo H, Pogoutse O, Datta S, Saier M, Crovella M, Vajda S, Moreno-Hagelsieb G, Parkinson J, Segre D, Babu M, Kozakov D, Emili A. Cell. 2025 Jan 22:S0092-8674(25)00032-7. doi: 10.1016/j.cell.2025.01.003. 10.1016/j.cell.2025.01.003 PubMed 39862855