pTMiniTrex-mCherry-Shark2
(Plasmid #233144)

• Purpose: Serves as a template plasmid for amplifying Shark2 (Tet-ON) hammerhead aptazyme-3xTy-tagging cassette
• Depositing Lab: Ronald Etheridge
• Publication: Wiedeman et al Proc Natl Acad Sci U S A. 2025 Feb 25;122(8):e2416009122. doi: 10.1073/pnas.2416009122. Epub 2025 Feb 18.

Backbone

• Vector backbone: pTMiniTrex
• Total vector size (bp): 4598
• Vector type: Prokaryotic expression
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: mCherry
• Species: Discosoma spp.
• Insert Size (bp): 705
• Mutation: Codon optimized for Trypanosoma cruzi
• GenBank ID: AAV52164
• Tag / Fusion Protein:
  • 3x Ty tag (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTCATGCCGTGTGCAATGTTTATTTGCG

Gene/Insert 2

• Gene/Insert name: Shark2
• Alt name: Tet-ON aptazyme derived from S. mansoni N79
• Species: Schistosoma mansoni
• Insert Size (bp): 108

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TTGTTTCCCAAAGATGACCATA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry