pTMiniTrex-mCherry-Shark1
(Plasmid
#233143)
-
PurposeServes as a template plasmid for amplifying Shark1 (Tet-OFF) hammerhead aptazyme-3xTy-tagging cassette
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 233143 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTMiniTrex
- Total vector size (bp) 4598
-
Vector typeProkaryotic expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namemCherry
-
SpeciesDiscosoma spp.
-
Insert Size (bp)705
-
MutationCodon optimized for Trypanosoma cruzi
-
GenBank IDAAV52164
-
Tag
/ Fusion Protein
- 3x Ty tag (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Other
- 5′ sequencing primer GTCATGCCGTGTGCAATGTTTATTTGCG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameShark1
-
Alt nameTc14 C110A aptazyme derived from S. mansoni N79
-
SpeciesSchistosoma mansoni
-
Insert Size (bp)150
-
Mutationchanged cytosine 110 to adenosine
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer TTGTTTCCCAAAGATGACCATA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTMiniTrex-mCherry-Shark1 was a gift from Ronald Etheridge (Addgene plasmid # 233143 ; http://n2t.net/addgene:233143 ; RRID:Addgene_233143) -
For your References section:
A limitation lifted: A conditional knockdown system reveals essential roles for Polo-like kinase and Aurora kinase 1 in Trypanosoma cruzi cell division. Wiedeman J, Harrison R, Etheridge RD. Proc Natl Acad Sci U S A. 2025 Feb 25;122(8):e2416009122. doi: 10.1073/pnas.2416009122. Epub 2025 Feb 18. 10.1073/pnas.2416009122 PubMed 40106484