pIVT-mGL
(Plasmid #232768)

• Purpose: IVT template for making modRNA encoding mGreenLantern
• Depositing Lab: Kate Galloway
• Publication: Blanch-Asensio et al bioRxiv [Preprint]. 2024 Oct 17:2024.10.17.616637. doi: 10.1101/2024.10.17.616637.

Backbone

• Vector backbone: pENTR4
• Backbone size w/o insert (bp): 1600
• Total vector size (bp): 3130
• Vector type: in vitro transcription

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: do not overgrow, as the segmented polyA track encoded on the plasmid can truncate in vivo.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: mGreenLantern
• Species: Synthetic
• Insert Size (bp): 720

Cloning Information

• Cloning method: Golden Gate
• 5′ sequencing primer: GGGAAACGCCTGGTATCTTT

Resource Information

• Supplemental Documents:
  • pKG03201.pIVT-mGL.seq

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The 5' and 3' beta globin UTR sequences flanking the ORF were based on previous literature for effective modRNA expression in hiPSCs: 10.1016/j.crmeth.2022.100290

To generate linear IVT template, digest the plasmid with MluI. The vector encodes a segmented polyA track, obviating the need for polyadenylation after IVT (doi: 10.1261/rna.069286.118).

Due to the inability of nanopore sequencing to accurately read long polyN stretches and the possibility of polyA truncation, the actual length of the polyA tail may differ when propagating the vector. In our hands, we have not seen measurable differences in expression across different plasmid preparations.