pIVT-Flp-2A-BleoR
(Plasmid #232752)

• Purpose: IVT template for making bicistronic modRNA encoding Flippase and Zeocin resistance gene
• Depositing Lab: Kate Galloway
• Publication: Blanch-Asensio et al bioRxiv [Preprint]. 2024 Oct 17:2024.10.17.616637. doi: 10.1101/2024.10.17.616637.

Backbone

• Vector backbone: pUC19
• Backbone size w/o insert (bp): 1725
• Total vector size (bp): 4044
• Vector type: in vitro transcription

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: FlpO
• Species: Synthetic
• Insert Size (bp): 1296

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GGGAAACGCCTGGTATCTTT

Gene/Insert 2

• Gene/Insert name: BleoR
• Species: Synthetic
• Insert Size (bp): 372

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gaggtgctggactacctgag

Resource Information

• Supplemental Documents:
  • pKG03212.pIVT-Flp-2A-Zeo.seq

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

PCR template for generating linear template for in vitro transcription. 5' and 3' beta globin UTR sequences were based on previous literature for effective modRNA expression in hiPSCs: 10.1016/j.crmeth.2022.100290

The primers used for generating PCR template also came from this work, and are as follows:

FWD: 5’- AGCTATAATACGACTCACTATAAGctcctgggcaacgtgctg-3’, which encodes the T7 promoter compatible with AG CleanCap reagent (upper-case bases) and binds to the 5’ UTR (lower-case bases)

REV: 5’-poly(T)116-GCAATGAAAATAAATGTTTTTTATTAGGCAGAAT-3’}, which encodes the poly(A) tail and binds to the 3’-UTR.