pLAS2w.Phyg-TIMD4
(Plasmid
#232670)
-
Purposeexpresses TIMD4 in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 232670 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLAS2w.Phyg
-
Backbone manufacturerNational RNAi Core Facility at Academia Sinica
- Backbone size w/o insert (bp) 8564
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTIMD4
-
Alt nameTIM4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1196
-
Entrez GeneTIMD4 (a.k.a. SMUCKLER, TIM4)
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CMV Forward
- 3′ sequencing primer ATTCTTTCCCCTGCACTGTAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLAS2w.Phyg-TIMD4 was a gift from Chen-Yang Shen (Addgene plasmid # 232670 ; http://n2t.net/addgene:232670 ; RRID:Addgene_232670)