Skip to main content
Addgene

lentiGuide-chr20-49345720-gRNA1
(Plasmid #232623)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 232623 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    lentiGuide-Hygro-eGFP (Addgene plasmid #99375)
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    S. pyogenes sgRNA cassette
  • gRNA/shRNA sequence
    ATGCGGCTACATTTAGTAAT
  • Species
    Synthetic
  • Promoter hU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer TCATATGCTTACCGTAACTTG
  • 3′ sequencing primer GCCAATTCCCACTCCTTTCAA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiGuide-chr20-49345720-gRNA1 was a gift from Claes Wadelius (Addgene plasmid # 232623 ; http://n2t.net/addgene:232623 ; RRID:Addgene_232623)
  • For your References section:

    Gain-of-function enhancer variant near KCNB1 causes familial ST-depression syndrome. Christensen AH, Pan G, Marvig RL, Rodriguez Gonzalez FG, Vissing CR, Silajdzija E, Frosted R, Girma EG, Gabrielaite M, Jensen HK, Rossing K, Henriksen FL, Sandgaard NCF, Ahlberg G, Ghouse J, Lundegaard PR, Weischenfeldt J, Wadelius C, Bundgaard H. Eur Heart J. 2025 Apr 10:ehaf213. doi: 10.1093/eurheartj/ehaf213. 10.1093/eurheartj/ehaf213 PubMed 40208226