lentiGuide-chr20-49345720-gRNA1
(Plasmid
#232623)
-
PurposeLentiviral plasmid expressing gRNA targeting the enhancer region in Chr20:49345720 (hg38) locus with lentiGuide-Hygro-eGFP (Addgene #99375) as backbone.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 232623 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonelentiGuide-Hygro-eGFP (Addgene plasmid #99375)
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameS. pyogenes sgRNA cassette
-
gRNA/shRNA sequenceATGCGGCTACATTTAGTAAT
-
SpeciesSynthetic
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer TCATATGCTTACCGTAACTTG
- 3′ sequencing primer GCCAATTCCCACTCCTTTCAA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiGuide-chr20-49345720-gRNA1 was a gift from Claes Wadelius (Addgene plasmid # 232623 ; http://n2t.net/addgene:232623 ; RRID:Addgene_232623) -
For your References section:
Gain-of-function enhancer variant near KCNB1 causes familial ST-depression syndrome. Christensen AH, Pan G, Marvig RL, Rodriguez Gonzalez FG, Vissing CR, Silajdzija E, Frosted R, Girma EG, Gabrielaite M, Jensen HK, Rossing K, Henriksen FL, Sandgaard NCF, Ahlberg G, Ghouse J, Lundegaard PR, Weischenfeldt J, Wadelius C, Bundgaard H. Eur Heart J. 2025 Apr 10:ehaf213. doi: 10.1093/eurheartj/ehaf213. 10.1093/eurheartj/ehaf213 PubMed 40208226