pU6_rd6_nsgRNA(PP7)
(Plasmid
#232434)
-
PurposensgRNA for PE3b correction of the rd6 mutation, contains a PP7 in the scaffold tetraloop
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 232434 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonephU6
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePP7-tagged nicking gRNA (PE3b) for rd6 correction driven by human U6 promoter
-
gRNA/shRNA sequenceg+CACCAGACCAGTAAGTCCCA
-
SpeciesSynthetic; Multiple
- Promoter U6
Cloning Information
- Cloning method Other
- 5′ sequencing primer GAGGGCCTATTTCCCATGATT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
HELMHOLTZ MUNICH has filed a patent (PCT/EP2025/053730) disclosing the capabilities of Material, and retains ownership rights to pU6_rd6_nsgRNA(PP7) Material.
Recipient agrees not to file for any intellectual property protection for Material.
Please note that any use of the Material or the HELMHOLTZ MUNICH Information for any commercial purpose - or by, on behalf of or in collaboration with any for-profit entity - requires a license from HELMHOLTZ MUNICH. To obtain such a license, please contact HELMHOLTZ MUNICH by directing your request to: [email protected]
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6_rd6_nsgRNA(PP7) was a gift from Gil Westmeyer (Addgene plasmid # 232434 ; http://n2t.net/addgene:232434 ; RRID:Addgene_232434) -
For your References section:
Engineered nucleocytosolic vehicles for loading of programmable editors. Geilenkeuser J, Armbrust N, Steinmaßl E, Du SW, Schmidt S, Binder EMH, Li Y, Warsing NW, Wendel SV, von der Linde F, Schiele EM, Niu X, Stroppel L, Berezin O, Santl TH, Orschmann T, Nelson K, Gruber C, Palczewska G, Rodrigues Menezes C, Risaliti E, Engfer ZJ, Koleci N, Adrea Schmidts A, Geerlof A, Palczewski K, Westmeyer GG, Truong DJ. Cell, April 2025. doi: 10.1016/j.cell.2025.03.015. 10.1016/j.cell.2025.03.015