pAAV-CA-FLEX-dtA
(Plasmid
#232236)
-
PurposeExpresses diphtheria toxin A subunit in Cre-positive cells.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 232236 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-CA-flex
-
Backbone manufacturerUchida lab (Harvard)
- Backbone size w/o insert (bp) 6058
- Total vector size (bp) 6058
-
Modifications to backboneThe dtA gene was inserted at EcoRV site
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDiphtheria toxin A subunit
-
Alt namedtA
-
SpeciesCorynebacterium ulcerans
-
Insert Size (bp)778
-
GenBank IDAB610405.1
- Promoter CA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (destroyed during cloning)
- 3′ cloning site SacI (destroyed during cloning)
- 5′ sequencing primer gcagaatggtagctggattg
- 3′ sequencing primer ccagaggttgattatcgataagc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byPhilippe Soriano, PGKdtabpA from Addgene Plasmid #13440
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2022.02.05.479267 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CA-FLEX-dtA was a gift from Naoshige Uchida (Addgene plasmid # 232236 ; http://n2t.net/addgene:232236 ; RRID:Addgene_232236) -
For your References section:
Dynamical management of potential threats regulated by dopamine and direct- and indirect-pathway neurons in the tail of the striatum. Tsutsui-Kimura I, Uchida N, Watabe-Uchida M. bioRxiv 2022.02.05.479267 10.1101/2022.02.05.479267