-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 23220 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backboneEGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3992
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBirA-mCherry
-
SpeciesTop10 E.coli, Discosoma sp.
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBY2982 was a gift from Ralf Baumeister (Addgene plasmid # 23220 ; http://n2t.net/addgene:23220 ; RRID:Addgene_23220) -
For your References section:
SnAvi - a new tandem tag for high-affinity protein-complex purification. Schaffer U, Schlosser A, Muller KM, Schafer A, Katava N, Baumeister R, Schulze E. Nucleic Acids Res. 2010 Jan 4. ():. 10.1093/nar/gkp1178 PubMed 20047968
Map uploaded by the depositor.
